thrR [2019-02-06 09:44:45]

transcription repressor of threonine biosynthetic genes

Locus: BSU27910

Isoelectric point: 6.36

Molecular weight: 16.52 kDa

Protein length: 147 aa

Gene length: 444 bp

Function: control of threonine biosynthesis

Product: transcription repressor of threonine biosynthetic genes

Essential: no

Synonyms: pheB,yszB

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of lysine/ threonine
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other

Gene

Coordinates: 2,852,157 2,852,600

The protein

Catalyzed reaction/ biological activity

• control of the threonine biosynthetic genes (hom-thrC-thrB and thrD) PubMed

Protein family

• UPF0735 family (according to Swiss-Prot)

Domains

• putative DNA binding signature (aa 19-51)
• ACT domain (aa 70 ... 145) (according to the Interpro database)

Effectors of protein activity

• lysine and cysteine (indirectly) inhibit DNA-binding activity of ThrR PubMed

Expression and Regulation

Operons

• Genes: spo0B-obg-thrR-pheA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Additional information

  • expression is repressed by binding of RpoE to the A-rich sequence in the -35 region of the promoter PubMed

Biological materials

Mutant

• BKE27910 (thrR::erm, available in the BGSC and in Jrg Stlke's and Fabian Commichau's labs) PubMed
• BKE27910 (thrR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGCATCCCCCCTTTAA, downstream forward: _UP4_GGTGCATAAGGGAGAGAAAA
• BKK27910 (thrR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGCATCCCCCCTTTAA, downstream forward: _UP4_GGTGCATAAGGGAGAGAAAA

Expression vectors

• pBP323 (N-terminal Strep-tag, in pGP172) (available in Fabian Commichau's lab) PubMed
• pBP620 (N-terminal Strep-tag, for SPINE, purification from B. subtilis, in pGP380) (available in Fabian Commichau's lab) PubMed
• pBP622 (C-terminal Strep-tag, for SPINE, purification from B. subtilis, in pGP382) (available in Fabian Commichau's lab) PubMed

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Fabian Commichau's lab PubMed

References

Loading